4C RESULTS

Dear W4CSEQ user, your submission (identifier: 860) was received at Thu Jun 2 18:37:23 2016 and processed at Thu Jun 2 18:37:29 2016.


4C RESULTS

Summary of parameters

ITEM VALUE
FASTQ_FILE
GENOME_BUILD mm10
RESTRICTION_ENZYME AAGCTT
BAIT_SEQUENCE ATCTGCTATTGAGGAAGCTT
BAIT_CHROMOSOME chr17
BAIT_START 35497036
BAIT_END 35504156
BIN_TRANS 500
BIN_CIS 100
WINDOW_CIS 3000
FDR 0.05

Summary of 4C metric

ITEM COUNT
Bait-containing reads 13854449
Bait-containing reads with good base quality (>=20) 13158824
Interaction reads after removing randomly aligned reads 9935559
    Interaction reads (cis) after removing randomly aligned reads 8396194
    Interaction reads (trans) after removing randomly aligned reads 1539365
Interacting sites 10460
    Interacting sites (cis) 4624
    Interacting sites (trans) 5836
Significant interacting sites 2652
    Significant interacting sites (cis) 1712
    Significant interacting sites (trans) 940
Significant interacting regions 121
    Significant interacting regions (cis) 30
    Significant interacting regions (trans) 91

Figures

500x500

Genome-wide distribution of 4C regions



500x500

Domainogram of intra-chromosomal interactions



500x500

Spider plot of intra-chromosomal interactions



500x500

Genome-wide interaction circos map



500x500

Distance distribution to key features



500x500

DNA replication timing of 4C regions



View in UCSC genome browser

view raw reads pile-up in UCSC genome browser
view captured sites summed in smoothing window in UCSC genome browser






Please send questions or comments to caim@usc.edu