Tutorial

You will know how to use w4CSeq by following this tutorial.

I. Basic Information

Email

Provide your email address, so that you can receive the result link when a submitted job is completed.

Input FASTQ file

Provide raw 4C FASTQ data. .gz format is accepted (and recommended for faster uploading). In addition, hard wired uploading is highly recommended for faster uploading.

Genome build

Choose the reference genome build you want to use for alignment.

Restriction enzyme

Choose the restriction enzyme you used for chromatin fragmentation. Choose primary enzyme if you take two rounds fragmentation strategy.


II. Specify a bait region

DNA sequence of 4C target region

Suppose chromatin is fragmented with HindIII, your bait primer ATCTGCTATTGAGGAAGCTT should contain a HindIII cutting site AAGCTT at end. Then you should input the DNA sequence ATCTGCTATTGAGGAAGCTT. The analysis cannot be performed if you input it wrong, such as ATCTGCTATTGAGG or AAGCTTATCTGCTATTGAGG.

Bait chromosome

Provide the chromosome that inverse primers target , e.g. chr17

Start position of inverse primer

Provide the start position of inverse primer-targeting enzyme-digested chromatin fragment, e.g. 35497036

End position of inverse primer

Provide the end position of inverse primer-targeting enzyme-digested chromatin fragment, e.g. 35504156

Example
500x500

In this scenario, you should input:
"ATCTGCTATTGAGGAAGCTT" as DNA sequence of 4C target region
"35497036" as Start position of inverse primer
"35504156" as End position of inverse primer


III. Parameters for statistical analysis

Bin size for TRANS chromosome

Provide genomic bin size (number of enzyme sites) for statistical analysis of inter-chromosomal interactions; the default is 500

Bin size for CIS chromosome

Provide genomic bin size (number of enzyme sites) for statistical analysis of inter-chromosomal interactions; the default is 100

Window size for CIS chromosome

Provide genomic window size (number of enzyme sites) for statistical analysis of intra-chromosomal interactions; the default is 3000

I. Basic Information

Email

Provide your email address, so that you can receive the result link when a submitted job is completed.

Input FASTQ file

Provide raw 4C FASTQ data; two FASTQ files from paired-end sequencing are needed. .gz format is accepted (and recommended for faster uploading). In addition, hard wired uploading is highly recommended for faster uploading.

Genome build

Choose the reference genome build you want to use for alignment.


II. Specify a bait region

Bait chromosome

Provide the chromosome that inverse primers target , e.g. chr17

Start position of inverse primer

Provide the the REVERSE targeted positions of inverse primer 3'end on Bait Chromosome, e.g. 35504676

End position of inverse primer

Provide the the FORWARD targeted positions of inverse primer 3'end on Bait Chromosome, e.g. 35504824

Extended length

Provide the extended length(bp) from the primer position for alignment purpose (default 500bp)

Example
500x500

In this scenario, you should input:
"35504676" as Start position of inverse primer
"35504824" as End position of inverse primer
Extension (default: 500bp) from the locations of the F1 and R1 primers are defined as bait for alignment.


III. Parameters for statistical analysis

Bin size for TRANS chromosome

Provide genomic bin size(bp) for statistical analysis of inter-chromosomal interactions; the default is 2000000

Bin size for CIS chromosome

Provide genomic bin size(bp) for statistical analysis of intra-chromosomal interactions; the default is 400000

Window size for CIS chromosome

Provide genomic window size(bp) for statistical analysis of intra-chromosomal interactions; the default is 12000000


How to build your own server or use command line?

Please refer to w4CSeq Github for detailed instructions on building server or using command line to analyze 4C-Seq data.

You need to download the lib directory.